pDest-1.7kbfabp6-eGFP-pA-CrymCherry
(Plasmid
#159088)
-
PurposeLR construct using backbone with Cry:mCherry insert to identify fish with transgene, and with p5E-1.7kbfabp6, pME-eGFP, and p3E-pA inserts
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 159088 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDESTtol2pACrymCherry
-
Backbone manufacturerBerger et. al.
-
Vector typefluorescent reporter
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert name1.7kb fabp6 promoter
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)1700
-
Entrez Genefabp6 (a.k.a. zgc:92421)
- Promoter 1.7kb fabp6
Cloning Information for Gene/Insert 1
- Cloning method TOPO Cloning
- 5′ sequencing primer ttaaggccggccGATGATCCCAACCCTGTAATGAGTTCCTGG
- 3′ sequencing primer aattggcgcgccTTGAGAGCTGAGGTACTGATGGGTGAAG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameeGFP
-
Alt nametol2kit #383 pME-EGFP
Cloning Information for Gene/Insert 2
- Cloning method Gateway Cloning
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
- 3′ sequencing primer CGTCGCCGTCCAGCTCGACCAG
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namepolyA
-
Alt nametol2kit #302 p3E-polyA
Cloning Information for Gene/Insert 3
- Cloning method Gateway Cloning
- 5′ sequencing primer GAAATTTGTGATGCTATTGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDest-1.7kbfabp6-eGFP-pA-CrymCherry was a gift from John Rawls (Addgene plasmid # 159088 ; http://n2t.net/addgene:159088 ; RRID:Addgene_159088) -
For your References section:
Fxr signaling and microbial metabolism of bile salts in the zebrafish intestine. Wen J, Mercado GP, Volland A, Doden HL, Lickwar CR, Crooks T, Kakiyama G, Kelly C, Cocchiaro JL, Ridlon JM, Rawls JF. Sci Adv. 2021 Jul 23;7(30). pii: 7/30/eabg1371. doi: 10.1126/sciadv.abg1371. Print 2021 Jul. 10.1126/sciadv.abg1371 PubMed 34301599