-
PurposeCre-dependent tetanus toxin light chain construct with nuclear-localized dTomato fluorophore for conditional silencing of neurons.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 159102 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV-hSyn-FLEX-TeLC-P2A-EYFP
- Backbone size w/o insert (bp) 4891
- Total vector size (bp) 7088
-
Modifications to backbonepAAV-hSyn-FLEX-TeLC-P2A-EYFP was digested with AscI and NheI to remove eYFP. A gene fragment containing dTomato with the SV40 nuclear localization signal was cloned into the TeLC backbone via isothermal assembly.
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTeLC-P2A-NLS-dTomato
-
Alt nameTetanus toxin light chain, TeLC, TeTxLC
-
Alt namedTomato, dTom
-
SpeciesSynthetic
-
Insert Size (bp)2187
-
GenBank IDAAV52168
- Promoter hSynapsin
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ctcagcgctgcctcagtct
- 3′ sequencing primer actgagatagagctgggcaaga
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-FLEX-TeLC-P2A-dTomato was a gift from Sandeep Datta (Addgene plasmid # 159102 ; http://n2t.net/addgene:159102 ; RRID:Addgene_159102) -
For your References section:
Structure and flexibility in cortical representations of odour space. Pashkovski SL, Iurilli G, Brann D, Chicharro D, Drummey K, Franks K, Panzeri S, Datta SR. Nature. 2020 Jul;583(7815):253-258. doi: 10.1038/s41586-020-2451-1. Epub 2020 Jul 1. 10.1038/s41586-020-2451-1 PubMed 32612230