Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV-hSyn-FLEX-TeLC-P2A-dTomato
(Plasmid #159102)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 159102 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-hSyn-FLEX-TeLC-P2A-EYFP
  • Backbone size w/o insert (bp) 4891
  • Total vector size (bp) 7088
  • Modifications to backbone
    pAAV-hSyn-FLEX-TeLC-P2A-EYFP was digested with AscI and NheI to remove eYFP. A gene fragment containing dTomato with the SV40 nuclear localization signal was cloned into the TeLC backbone via isothermal assembly.
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TeLC-P2A-NLS-dTomato
  • Alt name
    Tetanus toxin light chain, TeLC, TeTxLC
  • Alt name
    dTomato, dTom
  • Species
    Synthetic
  • Insert Size (bp)
    2187
  • GenBank ID
    AAV52168
  • Promoter hSynapsin

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ctcagcgctgcctcagtct
  • 3′ sequencing primer actgagatagagctgggcaaga
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn-FLEX-TeLC-P2A-dTomato was a gift from Sandeep Datta (Addgene plasmid # 159102 ; http://n2t.net/addgene:159102 ; RRID:Addgene_159102)
  • For your References section:

    Structure and flexibility in cortical representations of odour space. Pashkovski SL, Iurilli G, Brann D, Chicharro D, Drummey K, Franks K, Panzeri S, Datta SR. Nature. 2020 Jul;583(7815):253-258. doi: 10.1038/s41586-020-2451-1. Epub 2020 Jul 1. 10.1038/s41586-020-2451-1 PubMed 32612230