-
Purposehuman RNF160 (LTN1, ZNF294) FLAG mammalian expression vector.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 159138 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCMV-3Tag-8
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 5200
-
Modifications to backboneMCS replaced with new restriction sites: XhoI, HindIII, BamHI, NotI, ClaI
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namelisterin E3 ubiquitin protein ligase 1
-
Alt nameLTN1; RNF160; ZNF294; C21orf10; C21orf98
-
SpeciesH. sapiens (human)
-
Entrez GeneLTN1 (a.k.a. C21orf10, C21orf98, RNF160, ZNF294)
- Promoter CMV
-
Tag
/ Fusion Protein
- 3xFLAG (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (unknown if destroyed)
- 3′ cloning site ClaI (unknown if destroyed)
- 5′ sequencing primer AGCTGGTTTAGTGAACCGTCAGATC
- 3′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV3TAG8li-hRNF160-3FLAG was a gift from Martin Dorf (Addgene plasmid # 159138 ; http://n2t.net/addgene:159138 ; RRID:Addgene_159138) -
For your References section:
Mapping a dynamic innate immunity protein interaction network regulating type I interferon production. Li S, Wang L, Berman M, Kong YY, Dorf ME. Immunity. 2011 Sep 23;35(3):426-40. Epub 2011 Sep 8. 10.1016/j.immuni.2011.06.014 PubMed 21903422