pET28a-TS2126 RnlA-Strep
(Plasmid
#159350)
-
PurposeExpress TS2126 RNA ligase with His6 tag and Strep tag at N and C terminal, respectively
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 159350 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET28a
-
Backbone manufacturerMerck
- Backbone size w/o insert (bp) 5369
- Total vector size (bp) 6512
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth TemperatureRoom Temperature
-
Growth Strain(s)DH5alpha
-
Growth instructionsUse T7Express cells in L broth for protein expression.
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameTS2126 RNA ligase
-
SpeciesSynthetic; Thermus scotoductus bacteriophage TS2126
-
Insert Size (bp)1320
-
GenBank IDCQ796353
- Promoter T7
-
Tags
/ Fusion Proteins
- His6 (N terminal on backbone)
- Strep (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CGATCCCGCGAAATTAATACGACT
- 3′ sequencing primer GTTTAGAGGCCCCAAGGGGTTATGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28a-TS2126 RnlA-Strep was a gift from Takashi Ito (Addgene plasmid # 159350 ; http://n2t.net/addgene:159350 ; RRID:Addgene_159350) -
For your References section:
Short single-stranded DNAs with putative non-canonical structures comprise a new class of plasma cell-free DNA. Hisano O, Ito T, Miura F. BMC Biol. 2021 Oct 14;19(1):225. doi: 10.1186/s12915-021-01160-8. 10.1186/s12915-021-01160-8 PubMed 34649537