-
PurposeDelivery of dual sgRNA cassettes and Nme2Cas9 in a single AAV vector
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 159537 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonep1089: minimized AAV.sgRNA.Nme2Cas9
-
Vector typeMammalian Expression, Mouse Targeting, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNme2Cas9 with two guide RNA cassettes
-
Alt nameNeisseria meningitidis Cas9 nuclease
-
Alt nameNme2Cas9c
-
Insert Size (bp)4523
- Promoter U1a
-
Tags
/ Fusion Proteins
- NLS (N terminal on insert)
- NLS (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EagI (unknown if destroyed)
- 3′ cloning site None (unknown if destroyed)
- 5′ sequencing primer gatctccaccatagcccatc
- 3′ sequencing primer tgcacaagtatgacctgatcg
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2020.10.09.333997v1 for BioRxiv preprint
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEJS1099: Dual-sgRNA.Design 4 was a gift from Erik Sontheimer (Addgene plasmid # 159537 ; http://n2t.net/addgene:159537 ; RRID:Addgene_159537) -
For your References section:
Self-inactivating, all-in-one AAV vectors for precision Cas9 genome editing via homology-directed repair in vivo. Ibraheim R, Tai PWL, Mir A, Javeed N, Wang J, Rodriguez TC, Namkung S, Nelson S, Khokhar ES, Mintzer E, Maitland S, Chen Z, Cao Y, Tsagkaraki E, Wolfe SA, Wang D, Pai AA, Xue W, Gao G, Sontheimer EJ. Nat Commun. 2021 Nov 1;12(1):6267. doi: 10.1038/s41467-021-26518-y. 10.1038/s41467-021-26518-y PubMed 34725353