pEJS1096 Dual-sgRNA.Design 1
(Plasmid #159538)

• Purpose: Delivery of dual sgRNA cassettes and Nme2Cas9 in a single AAV vector
• Depositing Lab: Erik Sontheimer
• Publication: Ibraheim et al Nat Commun. 2021 Nov 1;12(1):6267. doi: 10.1038/s41467-021-26518-y.

Backbone

• Vector backbone: pEJS1089: mini-AAV.sgRNA.Nme2Cas9 (Addgene 159536)
• Total vector size (bp): 7287
• Vector type: Mammalian Expression, Mouse Targeting, AAV, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Nme2Cas9 nuclease with two guide RNA cassettes with promoters
• Alt name: Nm2Cas9
• Alt name: Neisseria meningitidis CRISPR Cas9
• Alt name: Nme2Cas9c
• Insert Size (bp): 4381
• Promoter: U1a
• Tags / Fusion Proteins:
  • NLS (N terminal on insert)
  • NLS (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (unknown if destroyed)
• 3′ cloning site: None (unknown if destroyed)
• 5′ sequencing primer: gatctccaccatagcccatc
• 3′ sequencing primer: tgcacaagtatgacctgatcg

Resource Information

• Supplemental Documents:
  • pEJS1096 Dual-sgRNA.Design 1.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2020.10.09.333997v1 for BioRxiv preprint