pEJS1099: Dual-sgRNA.Design 4
(Plasmid
#159537)
-
PurposeDelivery of dual sgRNA cassettes and Nme2Cas9 in a single AAV vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 159537 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonep1089: minimized AAV.sgRNA.Nme2Cas9
-
Vector typeMammalian Expression, Mouse Targeting, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNme2Cas9 with two guide RNA cassettes
-
Alt nameNeisseria meningitidis Cas9 nuclease
-
Insert Size (bp)4523
- Promoter U1a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EagI (unknown if destroyed)
- 3′ cloning site None (unknown if destroyed)
- 5′ sequencing primer gatctccaccatagcccatc
- 3′ sequencing primer tgcacaagtatgacctgatcg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2020.10.09.333997v1 for BioRxiv preprint
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEJS1099: Dual-sgRNA.Design 4 was a gift from Erik Sontheimer (Addgene plasmid # 159537 ; http://n2t.net/addgene:159537 ; RRID:Addgene_159537) -
For your References section:
Self-inactivating, all-in-one AAV vectors for precision Cas9 genome editing via homology-directed repair in vivo. Ibraheim R, Tai PWL, Mir A, Javeed N, Wang J, Rodriguez TC, Namkung S, Nelson S, Khokhar ES, Mintzer E, Maitland S, Chen Z, Cao Y, Tsagkaraki E, Wolfe SA, Wang D, Pai AA, Xue W, Gao G, Sontheimer EJ. Nat Commun. 2021 Nov 1;12(1):6267. doi: 10.1038/s41467-021-26518-y. 10.1038/s41467-021-26518-y PubMed 34725353