pSF11-wNIR-GECO2-T2A-HO1
(Plasmid
#159606)
-
PurposeCodon-optimized near-infrared fluorescent calcium indicator NIR-GECO2 with codon-optimized heme-oxygenase in C.elegans expression plasmid
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 159606 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSF11
- Backbone size w/o insert (bp) 6090
- Total vector size (bp) 8508
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namewNIR-GECO2-T2A-HO1
-
Alt nameCodon optimized NIR-GECO2 and HO1 for worm expression
-
SpeciesSynthetic
-
Insert Size (bp)2418
- Promoter tag-168
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ctagaggatccccgggattgg
- 3′ sequencing primer tgttgaagagtaattggacttagaagt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2020.04.08.032433v2 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSF11-wNIR-GECO2-T2A-HO1 was a gift from Robert Campbell (Addgene plasmid # 159606 ; http://n2t.net/addgene:159606 ; RRID:Addgene_159606) -
For your References section:
Improved genetically encoded near-infrared fluorescent calcium ion indicators for in vivo imaging. Qian Y, Cosio DMO, Piatkevich KD, Aufmkolk S, Su WC, Celiker OT, Schohl A, Murdock MH, Aggarwal A, Chang YF, Wiseman PW, Ruthazer ES, Boyden ES, Campbell RE. PLoS Biol. 2020 Nov 24;18(11):e3000965. doi: 10.1371/journal.pbio.3000965. eCollection 2020 Nov. 10.1371/journal.pbio.3000965 PubMed 33232322