-
PurposeConstitutive transient mammalian expression of m6A-Tracer protein (Kind et al. 2013) with a C-terminal HIV-1 Rev Nuclear Export Signal to reduce background due to nonspecific DNA interactions.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 159607 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 1100
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namem6A-Tracer-NES
-
Alt nameeGFP-DpnI_d7-NES
-
SpeciesSynthetic
-
Insert Size (bp)1100
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CMV-F (CGCAAATGGGCGGTAGGCGTG)
- 3′ sequencing primer SV40pA-R (GAAATTTGTGATGCTATTGC)
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bymodified from a gift from Bas van Steensel
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
dam-/dcm- strain should be used for downstream applications
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
m6A-Tracer-NES was a gift from Aaron Streets (Addgene plasmid # 159607 ; http://n2t.net/addgene:159607 ; RRID:Addgene_159607) -
For your References section:
muDamID: A Microfluidic Approach for Joint Imaging and Sequencing of Protein-DNA Interactions in Single Cells. Altemose N, Maslan A, Rios-Martinez C, Lai A, White JA, Streets A. Cell Syst. 2020 Oct 21;11(4):354-366.e9. doi: 10.1016/j.cels.2020.08.015. Epub 2020 Sep 23. 10.1016/j.cels.2020.08.015 PubMed 33099405