Skip to main content

RKS-Fzd7/8 subtype NGS Wnt
(Plasmid #159628)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 159628 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    RKS vector
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Fzd7/8 subtype NGS Wnt
  • Species
    Synthetic
  • Tag / Fusion Protein
    • His tag

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCGCGCTTCTGCTTCCCGAGC
  • 3′ sequencing primer GCGGCTTCGGCCAGTAACG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    RKS-Fzd7/8 subtype NGS Wnt was a gift from Chris Garcia (Addgene plasmid # 159628 ; http://n2t.net/addgene:159628 ; RRID:Addgene_159628)
  • For your References section:

    Next-Generation Surrogate Wnts Support Organoid Growth and Deconvolute Frizzled Pleiotropy In Vivo. Miao Y, Ha A, de Lau W, Yuki K, Santos AJM, You C, Geurts MH, Puschhof J, Pleguezuelos-Manzano C, Peng WC, Senlice R, Piani C, Buikema JW, Gbenedio OM, Vallon M, Yuan J, de Haan S, Hemrika W, Rosch K, Dang LT, Baker D, Ott M, Depeille P, Wu SM, Drost J, Nusse R, Roose JP, Piehler J, Boj SF, Janda CY, Clevers H, Kuo CJ, Garcia KC. Cell Stem Cell. 2020 Aug 14. pii: S1934-5909(20)30358-1. doi: 10.1016/j.stem.2020.07.020. 10.1016/j.stem.2020.07.020 PubMed 32818433