pAM-DCA-HA-Ast-3-NP-1-IRES-mCherry-WPRE
(Plasmid
#159630)
-
PurposeAAV expression of HA Allatostatin-3, neurophysin, IRES mCherry under the CAG promoter
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 159630 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAM
- Backbone size w/o insert (bp) 5364
- Total vector size (bp) 7050
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameAst
-
Alt nameAllatostatin-3, Ast,
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)1700
-
GenBank IDAE014297.3
-
Entrez GeneAstA (a.k.a. Dmel_CG13633, ALLS, AS, ASA, AST, AST-1, AST-3, AST-4, AST-A, Allatostatin A1, Allatostatin A2, Allatostatin A3, Allatostatin A4, Ast, Ast-A, AstA-1, AstA-2, AstA-3, AstA-4, AstA1, AstA2, AstA4, BcDNA:RE16553, CG13633, DAP, DAP-A, DST-1A, DST-2A, DST-3A, DST-4A, Dmel\CG13633, Drm-AST-1, Drm-AST-2, Drm-AST-3, Drm-AST-4, Drm-AST-A, ast)
- Promoter DCA (same as CAG promoter)
-
Tags
/ Fusion Proteins
- HA (N terminal on insert)
- neurophysin-1 (C terminal on insert)
- IRES (C terminal on insert)
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer HA F: TACCCATACGACGTCCCAGA
- 3′ sequencing primer mCherry R: TTGGTCACCTTCAGCTTGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plasmid features: CAG promoter: 271 -1152, Allatostatin: 1159- 1563, IRES: 1584- 2124, mCherry: 2155- 2859, WPRE: 2881- 3468
Please note: Plasmid contains K4M and G5D mutations in mCherry. These mutations do not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAM-DCA-HA-Ast-3-NP-1-IRES-mCherry-WPRE was a gift from Andrew Allen & Ross Bathgate (Addgene plasmid # 159630 ; http://n2t.net/addgene:159630 ; RRID:Addgene_159630) -
For your References section:
A Chemogenetic Tool that Enables Functional Neural Circuit Analysis. Ngo HB, Melo MR, Layfield S, Connelly AA, Bassi JK, Xie L, Menuet C, McDougall SJ, Bathgate RAD, Allen AM. Cell Rep. 2020 Sep 15;32(11):108139. doi: 10.1016/j.celrep.2020.108139. 10.1016/j.celrep.2020.108139 PubMed 32937120