pTYF-PRSx8-AstR-p2A-GFP
(Plasmid
#159632)
-
PurposeLentiviral expression of the Allatostatin receptor, P2A GFP under the PRSx8 promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 159632 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepTYF
- Backbone size w/o insert (bp) 7835
- Total vector size (bp) 10386
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameAstR
-
Alt nameAllatostatin receptor, AstR, AlstR,
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)1184
-
GenBank IDAF163775.1
-
Entrez GeneAstA-R1 (a.k.a. Dmel_CG2872, ASR, AST-R, AlstR, AstA R1, AstAR1, CG2872, D.AlstR1, DAR-1, DAR1, DGR, Dar-1, Dmel\CG2872, EG:121E7.2, GR)
- Promoter PRSx8
-
Tags
/ Fusion Proteins
- P2A (C terminal on insert)
- GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer PRSx8 F: CAGGTGGGACCAGAGAGCTCACCC
- 3′ sequencing primer GFP F: CAAAGACCCCAACGAGA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAstR sequence was cloned from addgene plasmid #14895
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plasmid features: AstR: 338 -1521, P2A: 1529 -1597, GFP: 1598 -2311 ,WPRE: 2373- 2969
Please note: Plasmid contains a 16bp deletion at the start of L-ITR. This deletion has no functional effect on the plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTYF-PRSx8-AstR-p2A-GFP was a gift from Andrew Allen (Addgene plasmid # 159632 ; http://n2t.net/addgene:159632 ; RRID:Addgene_159632) -
For your References section:
A Chemogenetic Tool that Enables Functional Neural Circuit Analysis. Ngo HB, Melo MR, Layfield S, Connelly AA, Bassi JK, Xie L, Menuet C, McDougall SJ, Bathgate RAD, Allen AM. Cell Rep. 2020 Sep 15;32(11):108139. doi: 10.1016/j.celrep.2020.108139. 10.1016/j.celrep.2020.108139 PubMed 32937120