pTYF-PRSx8-AstR-p2A-GFP
(Plasmid #159632)

• Purpose: Lentiviral expression of the Allatostatin receptor, P2A GFP under the PRSx8 promoter
• Depositing Lab: Andrew Allen
• Publication: Ngo et al Cell Rep. 2020 Sep 15;32(11):108139. doi: 10.1016/j.celrep.2020.108139.

Backbone

• Vector backbone: pTYF
• Backbone size w/o insert (bp): 7835
• Total vector size (bp): 10386
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: AstR
• Alt name: Allatostatin receptor, AstR, AlstR,
• Species: D. melanogaster (fly)
• Insert Size (bp): 1184
• GenBank ID: AF163775.1
• Entrez Gene: AstA-R1 (a.k.a. Dmel_CG2872, ASR, AST-R, AlstR, AstA R1, AstAR1, CG2872, D.AlstR1, DAR-1, DAR1, DGR, Dar-1, Dmel\CG2872, EG:121E7.2, GR)
• Promoter: PRSx8
• Tags / Fusion Proteins:
  • P2A (C terminal on insert)
  • GFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: PRSx8 F: CAGGTGGGACCAGAGAGCTCACCC
• 3′ sequencing primer: GFP F: CAAAGACCCCAACGAGA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: AstR sequence was cloned from addgene plasmid #14895

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Plasmid features: AstR: 338 -1521, P2A: 1529 -1597, GFP: 1598 -2311 ,WPRE: 2373- 2969

Please note: Plasmid contains a 16bp deletion at the start of L-ITR. This deletion has no functional effect on the plasmid.