Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAM-DCA-HA-Ast-3-NP-1-IRES-mCherry-WPRE
(Plasmid #159630)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 159630 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAM
  • Backbone size w/o insert (bp) 5364
  • Total vector size (bp) 7050
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Ast
  • Alt name
    Allatostatin-3, Ast,
  • Species
    D. melanogaster (fly)
  • Insert Size (bp)
    1700
  • GenBank ID
    AE014297.3
  • Entrez Gene
    AstA (a.k.a. Dmel_CG13633, ALLS, AS, ASA, AST, AST-1, AST-3, AST-4, AST-A, Allatostatin A1, Allatostatin A2, Allatostatin A3, Allatostatin A4, Ast, Ast-A, AstA-1, AstA-2, AstA-3, AstA-4, AstA1, AstA2, AstA4, BcDNA:RE16553, CG13633, DAP, DAP-A, DST-1A, DST-2A, DST-3A, DST-4A, Dmel\CG13633, Drm-AST-1, Drm-AST-2, Drm-AST-3, Drm-AST-4, Drm-AST-A, ast)
  • Promoter DCA (same as CAG promoter)
  • Tags / Fusion Proteins
    • HA (N terminal on insert)
    • neurophysin-1 (C terminal on insert)
    • IRES (C terminal on insert)
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer HA F: TACCCATACGACGTCCCAGA
  • 3′ sequencing primer mCherry R: TTGGTCACCTTCAGCTTGG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid features: CAG promoter: 271 -1152, Allatostatin: 1159- 1563, IRES: 1584- 2124, mCherry: 2155- 2859, WPRE: 2881- 3468

Please note: Plasmid contains K4M and G5D mutations in mCherry. These mutations do not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAM-DCA-HA-Ast-3-NP-1-IRES-mCherry-WPRE was a gift from Andrew Allen & Ross Bathgate (Addgene plasmid # 159630 ; http://n2t.net/addgene:159630 ; RRID:Addgene_159630)
  • For your References section:

    A Chemogenetic Tool that Enables Functional Neural Circuit Analysis. Ngo HB, Melo MR, Layfield S, Connelly AA, Bassi JK, Xie L, Menuet C, McDougall SJ, Bathgate RAD, Allen AM. Cell Rep. 2020 Sep 15;32(11):108139. doi: 10.1016/j.celrep.2020.108139. 10.1016/j.celrep.2020.108139 PubMed 32937120