pPaGE Pyl TAG FliC T248TAG
(Plasmid
#160089)
-
PurposeEncodes for MmPyl tRNA synthetase/tRNA pair and for flagellin protein (FliC) with TAG mutation at site 248, for unnatural amino acid incorporation into the flagellin protein in Pseudomonas aeruginosa.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 160089 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMRP9-1
- Backbone size w/o insert (bp) 4756
- Total vector size (bp) 8660
-
Modifications to backboneRemains of partial URA3 gene for selection in yeast from previous yeast assembly, however no longer contains the full sequence for the procedure and only pMRP9-1 origins and selection remained.
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namePyrrolysyl tRNA(cua) (Methanosarcina mazei)
-
Alt nameMmPyl-tRNA
-
SpeciesMethanosarcina mazei
-
Insert Size (bp)72
- Promoter Pseudomonas aeruginosa Leu-tRNA native promoter and terminator
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer TAACCCAGATGCCGCTGGATC
- 3′ sequencing primer ACGCTAAGCTTGCCCTATGG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namePyrrolysyl tRNA synthetase (Methanosarcina mazei)
-
Alt nameMmPylRS
-
SpeciesMethanosarcina mazei
-
Insert Size (bp)1365
- Promoter Pseudomonas aeruginosa LeuRS native promoter and terminator
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer ACCCAAGTCGATGAGCGATC
- 3′ sequencing primer AACAGGGCACGCCGGGCATG
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameFlagellin
-
Alt nameFliC
-
SpeciesPseudomonas aeruginosa
-
Insert Size (bp)1467
-
MutationChanged Threonine 248 to TAG stop-codon.
- Promoter Pseudomonas aeruginosa fliC native promoter and terminator
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer ACAGGAGTGAGGGAAGCTTG
- 3′ sequencing primer GCGGATAATGCCTTTAGCGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPaGE Pyl TAG FliC T248TAG was a gift from Lital Alfonta (Addgene plasmid # 160089 ; http://n2t.net/addgene:160089 ; RRID:Addgene_160089) -
For your References section:
An inside look at a biofilm: Pseudomonas aeruginosa flagella biotracking. Ozer E, Yaniv K, Chetrit E, Boyarski A, Meijler MM, Berkovich R, Kushmaro A, Alfonta L. Sci Adv. 2021 Jun 11;7(24). pii: 7/24/eabg8581. doi: 10.1126/sciadv.abg8581. Print 2021 Jun. 10.1126/sciadv.abg8581 PubMed 34117070