Skip to main content

pPaGE Pyl TAG FliC T248TAG
(Plasmid #160089)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 160089 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMRP9-1
  • Backbone size w/o insert (bp) 4756
  • Total vector size (bp) 8660
  • Modifications to backbone
    Remains of partial URA3 gene for selection in yeast from previous yeast assembly, however no longer contains the full sequence for the procedure and only pMRP9-1 origins and selection remained.
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    Pyrrolysyl tRNA(cua) (Methanosarcina mazei)
  • Alt name
    MmPyl-tRNA
  • Species
    Methanosarcina mazei
  • Insert Size (bp)
    72
  • Promoter Pseudomonas aeruginosa Leu-tRNA native promoter and terminator

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAACCCAGATGCCGCTGGATC
  • 3′ sequencing primer ACGCTAAGCTTGCCCTATGG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Pyrrolysyl tRNA synthetase (Methanosarcina mazei)
  • Alt name
    MmPylRS
  • Species
    Methanosarcina mazei
  • Insert Size (bp)
    1365
  • Promoter Pseudomonas aeruginosa LeuRS native promoter and terminator

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ACCCAAGTCGATGAGCGATC
  • 3′ sequencing primer AACAGGGCACGCCGGGCATG
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    Flagellin
  • Alt name
    FliC
  • Species
    Pseudomonas aeruginosa
  • Insert Size (bp)
    1467
  • Mutation
    Changed Threonine 248 to TAG stop-codon.
  • Promoter Pseudomonas aeruginosa fliC native promoter and terminator

Cloning Information for Gene/Insert 3

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ACAGGAGTGAGGGAAGCTTG
  • 3′ sequencing primer GCGGATAATGCCTTTAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPaGE Pyl TAG FliC T248TAG was a gift from Lital Alfonta (Addgene plasmid # 160089 ; http://n2t.net/addgene:160089 ; RRID:Addgene_160089)
  • For your References section:

    An inside look at a biofilm: Pseudomonas aeruginosa flagella biotracking. Ozer E, Yaniv K, Chetrit E, Boyarski A, Meijler MM, Berkovich R, Kushmaro A, Alfonta L. Sci Adv. 2021 Jun 11;7(24). pii: 7/24/eabg8581. doi: 10.1126/sciadv.abg8581. Print 2021 Jun. 10.1126/sciadv.abg8581 PubMed 34117070