Skip to main content

pAAV-Ef1a-DIO-Sun1GFP-WPRE-pA
(Plasmid #160141)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 160141 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAAV-Ef1a-DIO-EGFP-WPRE-pA
  • Backbone manufacturer
    Bernardo Sabatini Lab
  • Backbone size w/o insert (bp) 5662
  • Total vector size (bp) 6342
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Sun1-GFP
  • Alt name
    Sun1-sfGFP
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2370
  • Mutation
    N-truncated: removed amino acids 1-207, retained 208-757
  • GenBank ID
    NM_001256118.1
  • Entrez Gene
    Sun1 (a.k.a. 4632417G13Rik, 5730434D03Rik, Unc84a, mKIAA0810)
  • Promoter Ef1a
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SgsI (not destroyed)
  • 3′ cloning site BspoI (not destroyed)
  • 5′ sequencing primer CCAGCTTGGCACTTGATGTA
  • 3′ sequencing primer AGTCATGCCGTTTCATGTGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Ef1a-DIO-Sun1GFP-WPRE-pA was a gift from Andreas Pfenning (Addgene plasmid # 160141 ; http://n2t.net/addgene:160141 ; RRID:Addgene_160141)
  • For your References section:

    Cell type-specific oxidative stress genomic signatures in the globus pallidus of dopamine depleted mice. Lawler AJ, Brown AR, Bouchard RS, Toong N, Kim Y, Velraj N, Fox G, Kleyman M, Kang B, Gittis AH, Pfenning AR. J Neurosci. 2020 Nov 10. pii: JNEUROSCI.1634-20.2020. doi: 10.1523/JNEUROSCI.1634-20.2020. 10.1523/JNEUROSCI.1634-20.2020 PubMed 33188066