Per2:iLuc
(Plasmid
#160293)
-
Purposetarget Per2 gene with a color-switching luciferase cassette in mouse genome and the transfection of the recombinant DNA will lead genomic recombination and make a knock-in allele in mouse ES cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 160293 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonehomemade
-
Backbone manufacturerhomemade
- Backbone size w/o insert (bp) 12590
- Total vector size (bp) 5100
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePer2LUC
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1250
- Promoter no promotor
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer 5’ ACCTCAGAAGCCAAAGAGGAG
- 3′ sequencing primer 3’ GGGTCCATGTGATTAGAAACC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note Addgene NGS had a hard time assembling highly repetitive regions in this plasmid. There are several small deletions in the Per2 intron region. Depositor confirms plasmid is functional and recommends perform long, sanger sequencing with relay primers to confirm the exact sequence of this repetitive region.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Per2:iLuc was a gift from Joseph Takahashi (Addgene plasmid # 160293 ; http://n2t.net/addgene:160293 ; RRID:Addgene_160293) -
For your References section:
Dual-Color Single-Cell Imaging of the Suprachiasmatic Nucleus Reveals a Circadian Role in Network Synchrony. Shan Y, Abel JH, Li Y, Izumo M, Cox KH, Jeong B, Yoo SH, Olson DP, Doyle FJ 3rd, Takahashi JS. Neuron. 2020 Aug 4. pii: S0896-6273(20)30529-8. doi: 10.1016/j.neuron.2020.07.012. 10.1016/j.neuron.2020.07.012 PubMed 32768389