pHX_gRNA_hPAX7_6-9S
(Plasmid
#160453)
-
PurposesgRNA targeting human PAX7 3' UTR with 17bp spacer
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 160453 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonegRNA_Cloning Vector
-
Backbone manufacturer41824
- Backbone size w/o insert (bp) 3910
- Total vector size (bp) 3970
-
Modifications to backboneThe AflII site was destroyed during cloning which results in a loss of 4 bp from the original backbone (3914 bp)
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegRNA_hPAX7_6-9S
-
gRNA/shRNA sequenceGTGAGTGGGTGTACGTG
-
SpeciesH. sapiens (human)
-
GenBank IDNM_001135254
- Promoter U6
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer T7: TAATACGACTCACTATAGGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHX_gRNA_hPAX7_6-9S was a gift from April Pyle (Addgene plasmid # 160453 ; http://n2t.net/addgene:160453 ; RRID:Addgene_160453) -
For your References section:
Generation of PAX7 Reporter Cells to Investigate Skeletal Myogenesis from Human Pluripotent Stem Cells. Xi H, Young CS, Pyle AD. STAR Protoc. 2020 Nov 5;1(3):100158. doi: 10.1016/j.xpro.2020.100158. eCollection 2020 Dec 18. 10.1016/j.xpro.2020.100158 PubMed 33377052