pUPD2 HDV (GB1444)
(Plasmid
#160576)
-
PurposeHepatitis Delta Virus ribozyme signal for the assembly of gRNA expression cassettes.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 160576 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepUPD2
-
Backbone manufacturerself-made; derived from the BioBrick assembly plasmid pSB1C3
-
Vector typeCRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHDV
-
SpeciesSynthetic; Hepatitis Delta Virus
-
Insert Size (bp)76
-
MutationBsaI and BsmBI sites removed
- Promoter U6-26
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer gctttcgctaaggatgatttctgg
- 3′ sequencing primer cagggtggtgacaccttgcc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Compatible with GoldenBraid; insert can be released with BsaI
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUPD2 HDV (GB1444) was a gift from Diego Orzaez (Addgene plasmid # 160576 ; http://n2t.net/addgene:160576 ; RRID:Addgene_160576) -
For your References section:
Assessment of Cas12a-mediated gene editing efficiency in plants. Bernabe-Orts JM, Casas-Rodrigo I, Minguet EG, Landolfi V, Garcia-Carpintero V, Gianoglio S, Vazquez-Vilar M, Granell A, Orzaez D. Plant Biotechnol J. 2019 Apr 5. doi: 10.1111/pbi.13113. 10.1111/pbi.13113 PubMed 30950179