pGS_129
(Plasmid
#160652)
-
PurposeExpresses Human APOE4 with a yeast secretory signal peptide under the control of a beta-estradiol inducible promoter
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 160652 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepNH605
- Backbone size w/o insert (bp) 7913
- Total vector size (bp) 8970
-
Modifications to backbonepZ promoter (replaces GAL1 promoter)
-
Vector typeYeast Expression
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameApolipoprotein E e4
-
Alt nameAPOE4
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1023
-
Mutatione4 allele
-
Entrez GeneAPOE (a.k.a. AD2, APO-E, ApoE4, LDLCQ5, LPG)
- Promoter pZ estradiol inducible promoter
-
Tag
/ Fusion Protein
- Kar2 signal sequence
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AATATACCTCTATACTTTAACGTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGS_129 was a gift from Susan Lindquist & Li-Huei Tsai (Addgene plasmid # 160652 ; http://n2t.net/addgene:160652 ; RRID:Addgene_160652) -
For your References section:
APOE4 disrupts intracellular lipid homeostasis in human iPSC-derived glia. Sienski G, Narayan P, Bonner JM, Kory N, Boland S, Arczewska AA, Ralvenius WT, Akay L, Lockshin E, He L, Milo B, Graziosi A, Baru V, Lewis CA, Kellis M, Sabatini DM, Tsai LH, Lindquist S. Sci Transl Med. 2021 Mar 3;13(583). pii: 13/583/eaaz4564. doi: 10.1126/scitranslmed.aaz4564. 10.1126/scitranslmed.aaz4564 PubMed 33658354