Skip to main content

pRN120
(Plasmid #160696)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 160696 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTRANS_221
  • Backbone manufacturer
    Voytas Lab
  • Total vector size (bp) 16395
  • Vector type
    Luciferase ; Gemini viral replicon, plant developmental regulators
  • Selectable markers
    Kanamycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    CmYLCV::Luc+::AtHSP
  • Species
    A. thaliana (mustard weed); Firefly, Cestrum yellow leaf curling virus.
  • Insert Size (bp)
    2384
  • Promoter CmYLCV

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site None (destroyed during cloning)
  • 3′ cloning site None (destroyed during cloning)
  • 5′ sequencing primer ctagaagtagtcaaggcggc
  • 3′ sequencing primer ccaagaagggcggaaagatcg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Nos::WUS2::PinII
  • Species
    A. thaliana (mustard weed); Agrobacterium tumefaciens, Zea mays
  • Insert Size (bp)
    2049
  • Promoter Nos

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site None (destroyed during cloning)
  • 3′ cloning site None (destroyed during cloning)
  • 5′ sequencing primer tgctccactgacgttccataaattc
  • 3′ sequencing primer tgctgctggacacgagttc
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    AtUbi10::STM::35S
  • Species
    A. thaliana (mustard weed); Cauliflower mosaic virus
  • Insert Size (bp)
    2667
  • Promoter AtUbi10

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site None (destroyed during cloning)
  • 3′ cloning site None (destroyed during cloning)
  • 5′ sequencing primer ggtgttagtttctagtttgtgcgatcg
  • 3′ sequencing primer tcccagataagggaattagggttcc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRN120 was a gift from Daniel Voytas (Addgene plasmid # 160696 ; http://n2t.net/addgene:160696 ; RRID:Addgene_160696)
  • For your References section:

    Plant gene editing through de novo induction of meristems. Maher MF, Nasti RA, Vollbrecht M, Starker CG, Clark MD, Voytas DF. Nat Biotechnol. 2019 Dec 16. pii: 10.1038/s41587-019-0337-2. doi: 10.1038/s41587-019-0337-2. 10.1038/s41587-019-0337-2 PubMed 31844292