-
PurposeBeYDV viral replicon on T-DNA backbone expressing Firefly Luc+, CmYLCV::STM::35S terminator, Nos::WUS2::PinII terminator
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 160696 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTRANS_221
-
Backbone manufacturerVoytas Lab
- Total vector size (bp) 16395
-
Vector typeLuciferase ; Gemini viral replicon, plant developmental regulators
-
Selectable markersKanamycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameCmYLCV::Luc+::AtHSP
-
SpeciesA. thaliana (mustard weed); Firefly, Cestrum yellow leaf curling virus.
-
Insert Size (bp)2384
- Promoter CmYLCV
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site None (destroyed during cloning)
- 3′ cloning site None (destroyed during cloning)
- 5′ sequencing primer ctagaagtagtcaaggcggc
- 3′ sequencing primer ccaagaagggcggaaagatcg
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameNos::WUS2::PinII
-
SpeciesA. thaliana (mustard weed); Agrobacterium tumefaciens, Zea mays
-
Insert Size (bp)2049
- Promoter Nos
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site None (destroyed during cloning)
- 3′ cloning site None (destroyed during cloning)
- 5′ sequencing primer tgctccactgacgttccataaattc
- 3′ sequencing primer tgctgctggacacgagttc
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameAtUbi10::STM::35S
-
SpeciesA. thaliana (mustard weed); Cauliflower mosaic virus
-
Insert Size (bp)2667
- Promoter AtUbi10
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site None (destroyed during cloning)
- 3′ cloning site None (destroyed during cloning)
- 5′ sequencing primer ggtgttagtttctagtttgtgcgatcg
- 3′ sequencing primer tcccagataagggaattagggttcc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRN120 was a gift from Daniel Voytas (Addgene plasmid # 160696 ; http://n2t.net/addgene:160696 ; RRID:Addgene_160696) -
For your References section:
Plant gene editing through de novo induction of meristems. Maher MF, Nasti RA, Vollbrecht M, Starker CG, Clark MD, Voytas DF. Nat Biotechnol. 2019 Dec 16. pii: 10.1038/s41587-019-0337-2. doi: 10.1038/s41587-019-0337-2. 10.1038/s41587-019-0337-2 PubMed 31844292