Skip to main content
Addgene
Open Menu

pUC19_CRISPR_DpmrA
(Plasmid #160903)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 160903 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 160903-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 160903-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pUC19
  • Backbone size w/o insert (bp) 2686
  • Total vector size (bp) 11298
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Bleocin (Zeocin), 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Cas9
  • Species
    Streptococcus thermophilus
  • Promoter araBAD

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site sbf1 (not destroyed)
  • 3′ cloning site xba1 (not destroyed)
  • 5′ sequencing primer -
  • 3′ sequencing primer tctagattaagaaataatcttcatc
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Lambda Red Recombineering Genes
  • Promoter araBAD

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site xba1 (not destroyed)
  • 3′ cloning site xba1 (not destroyed)
  • 5′ sequencing primer tctagattctactggtattggcaca
  • 3′ sequencing primer tctagacatgagcggatacatattt
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    Zeocin Resistance Cassette

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site eco0109i (not destroyed)
  • 3′ cloning site eco0109i (not destroyed)
  • 5′ sequencing primer agGGCCTATTATTAACGCTTACAAT
  • 3′ sequencing primer aggccCTGTCTGACGCTCAGTGGAA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Addgene Plasmid #62225: pCas

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

zeocin was cloned from the pCR2.1 topo gene from the invitrogen blunt topo plasmid

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUC19_CRISPR_DpmrA was a gift from Anne-Catrin Uhlemann (Addgene plasmid # 160903 ; http://n2t.net/addgene:160903 ; RRID:Addgene_160903)

  • For your References section:

    CrrB Positively Regulates High-Level Polymyxin Resistance and Virulence in Klebsiella pneumoniae. McConville TH, Annavajhala MK, Giddins MJ, Macesic N, Herrera CM, Rozenberg FD, Bhushan GL, Ahn D, Mancia F, Trent MS, Uhlemann AC. Cell Rep. 2020 Oct 27;33(4):108313. doi: 10.1016/j.celrep.2020.108313. 10.1016/j.celrep.2020.108313 PubMed 33113377
Related items:
Commonly requested with: