pUC19_CRISPR_DpmrA
(Plasmid #160903)

• Purpose: CRISPR_Cas9, lambda red recombineering
• Depositing Lab: Anne-Catrin Uhlemann
• Publication: McConville et al Cell Rep. 2020 Oct 27;33(4):108313. doi: 10.1016/j.celrep.2020.108313.

Backbone

• Vector backbone: pUC19
• Backbone size w/o insert (bp): 2686
• Total vector size (bp): 11298
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Bleocin (Zeocin), 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Cas9
• Species: Streptococcus thermophilus
• Promoter: araBAD

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: sbf1 (not destroyed)
• 3′ cloning site: xba1 (not destroyed)
• 5′ sequencing primer: -
• 3′ sequencing primer: tctagattaagaaataatcttcatc

Gene/Insert 2

• Gene/Insert name: Lambda Red Recombineering Genes
• Promoter: araBAD

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: xba1 (not destroyed)
• 3′ cloning site: xba1 (not destroyed)
• 5′ sequencing primer: tctagattctactggtattggcaca
• 3′ sequencing primer: tctagacatgagcggatacatattt

Gene/Insert 3

• Gene/Insert name: Zeocin Resistance Cassette

Cloning Information for Gene/Insert 3

• Cloning method: Restriction Enzyme
• 5′ cloning site: eco0109i (not destroyed)
• 3′ cloning site: eco0109i (not destroyed)
• 5′ sequencing primer: agGGCCTATTATTAACGCTTACAAT
• 3′ sequencing primer: aggccCTGTCTGACGCTCAGTGGAA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Addgene Plasmid #62225: pCas
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

zeocin was cloned from the pCR2.1 topo gene from the invitrogen blunt topo plasmid