-
PurposeRUBY under the control of CaMV 35S promoter/marker for transformation
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 160908 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHDE
- Backbone size w/o insert (bp) 9346
- Total vector size (bp) 14237
-
Vector typePlant Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRUBY and CaMV 35S promoter
-
SpeciesSynthetic; Cauliflower mosaic virus
-
Insert Size (bp)4892
- Promoter CaMV 35S
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCTGTCAAACACTGATAGTTTtgagacttttcaacaaagggt
- 3′ sequencing primer GCTTACTCAGTTAGGTCTAGCTTATCTTTAATCATATTCCATAGTCCA (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
35S:RUBY was a gift from Yunde Zhao (Addgene plasmid # 160908 ; http://n2t.net/addgene:160908 ; RRID:Addgene_160908) -
For your References section:
A reporter for noninvasively monitoring gene expression and plant transformation. He Y, Zhang T, Sun H, Zhan H, Zhao Y. Hortic Res. 2020 Sep 19;7:152. doi: 10.1038/s41438-020-00390-1. eCollection 2020. 10.1038/s41438-020-00390-1 PubMed 33024566