pCTCON2-GYB
(Plasmid
#160927)
-
PurposeDual fluorescent protein reporter (GFP-BFP) for ncAA incorporation (wild-type construct)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 160927 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCTCON2
- Backbone size w/o insert (bp) 6314
- Total vector size (bp) 7193
-
Vector typeYeast Expression
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameBFP
-
Insert Size (bp)699
- Promoter GAL1-10
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CTGCATAACCACTTTAACTAATACTTTC
- 3′ sequencing primer GTAAAGTTGGTAACGGAACG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namesfGFP
-
Insert Size (bp)720
- Promoter GAL1-10
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer CTGCATAACCACTTTAACTAATACTTTC
- 3′ sequencing primer GTAAAGTTGGTAACGGAACG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe GFP gene was originally amplified from pRYG, obtained from the laboratory of Jeffrey Barrick at The University of Texas Austin (Addgene plasmid #113642). The BFP gene was originally amplified from pBAD-mTagBFP2, obtained from the laboratory of Nikhil U. Nair at Tufts University and originally purchased from Addgene (Addgene plasmid #34632)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCTCON2-GYB was a gift from James Van Deventer (Addgene plasmid # 160927 ; http://n2t.net/addgene:160927 ; RRID:Addgene_160927) -
For your References section:
Reporter system architecture affects measurements of noncanonical amino acid incorporation efficiency and fidelity. Potts KA, Stieglitz JT, Lei M, Van Deventer JA. Mol Syst Des Eng. 2020 Feb 1;5(2):573-588. doi: 10.1039/c9me00107g. Epub 2020 Jan 23. 10.1039/c9me00107g PubMed 33791108