Skip to main content
Addgene

THI VP64 pGAP T1
(Plasmid #161488)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 161488 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Addgene#98552 BB3rN_AD
  • Backbone size w/o insert (bp) 3000
  • Total vector size (bp) 10847
  • Vector type
    Yeast Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Nourseothricin (clonNat), 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    dCAS9
  • Promoter pTEF2

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer gaggtatgtaggcggtgcta
  • 3′ sequencing primer GTACTGTGTCGTGAAGGC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    MS2-VP64
  • Promoter pPOR1

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer GCCTTCACGACACAGTAC
  • 3′ sequencing primer GACAGTGGAGGAAAATAATGTGC
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    gRNA (Targeting T1 in the THI11 promoter)
  • Promoter pGAP

Cloning Information for Gene/Insert 3

  • Cloning method Unknown
  • 5′ sequencing primer GCACATTATTTTCCTCCACTGTC
  • 3′ sequencing primer ttatatttctctacaggggc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    THI VP64 pGAP T1 was a gift from Brigitte Gasser & Diethard Mattanovich (Addgene plasmid # 161488 ; http://n2t.net/addgene:161488 ; RRID:Addgene_161488)
  • For your References section:

    Fine-Tuning of Transcription in Pichia pastoris Using dCas9 and RNA Scaffolds. Baumschabl M, Prielhofer R, Mattanovich D, Steiger MG. ACS Synth Biol. 2020 Dec 18;9(12):3202-3209. doi: 10.1021/acssynbio.0c00214. Epub 2020 Nov 12. 10.1021/acssynbio.0c00214 PubMed 33180466