Skip to main content
Addgene

pBC001 v3
(Plasmid #161711)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 161711 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLVSIN-CMV-Puro
  • Backbone manufacturer
    TaKaRa
  • Vector type
    Mammalian Expression, Lentiviral, Synthetic Biology
  • Promoter CMV Promoter
  • Selectable markers
    Puromycin ; Constitutive active EGFP can be selection marker for FACS

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer CGTGTACGGTGGGAGGTCTA
  • 3′ sequencing primer CTAAAGCGCATGCTCCAGAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

XbaI and BamHI digestion sites in the 3' UTR of EGFP can be used for the generation of random barcode library.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBC001 v3 was a gift from Nozomu Yachie (Addgene plasmid # 161711 ; http://n2t.net/addgene:161711 ; RRID:Addgene_161711)
  • For your References section:

    Heart failure promotes multimorbidity through innate immune memory. Nakayama Y, Fujiu K, Oshima T, Matsuda J, Sugita J, Matsubara TJ, Liu Y, Goto K, Kani K, Uchida R, Takeda N, Morita H, Xiao Y, Hayashi M, Maru Y, Hasumi E, Kojima T, Ishiguro S, Kijima Y, Yachie N, Yamazaki S, Yamamoto R, Kudo F, Nakanishi M, Iwama A, Fujiki R, Kaneda A, Ohara O, Nagai R, Manabe I, Komuro I. Sci Immunol. 2024 May 24;9(95):eade3814. doi: 10.1126/sciimmunol.ade3814. Epub 2024 May 24. 10.1126/sciimmunol.ade3814 PubMed 38787963