pBC001 v3
(Plasmid
#161711)
-
Purpose(Empty Backbone) CMVp-EGFP-[barcode cloning site]-PGKp-Puro-WPRE
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 161711 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLVSIN-CMV-Puro
-
Backbone manufacturerTaKaRa
-
Vector typeMammalian Expression, Lentiviral, Synthetic Biology
- Promoter CMV Promoter
-
Selectable markersPuromycin ; Constitutive active EGFP can be selection marker for FACS
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer CGTGTACGGTGGGAGGTCTA
- 3′ sequencing primer CTAAAGCGCATGCTCCAGAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
XbaI and BamHI digestion sites in the 3' UTR of EGFP can be used for the generation of random barcode library.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBC001 v3 was a gift from Nozomu Yachie (Addgene plasmid # 161711 ; http://n2t.net/addgene:161711 ; RRID:Addgene_161711) -
For your References section:
Heart failure promotes multimorbidity through innate immune memory. Nakayama Y, Fujiu K, Oshima T, Matsuda J, Sugita J, Matsubara TJ, Liu Y, Goto K, Kani K, Uchida R, Takeda N, Morita H, Xiao Y, Hayashi M, Maru Y, Hasumi E, Kojima T, Ishiguro S, Kijima Y, Yachie N, Yamazaki S, Yamamoto R, Kudo F, Nakanishi M, Iwama A, Fujiki R, Kaneda A, Ohara O, Nagai R, Manabe I, Komuro I. Sci Immunol. 2024 May 24;9(95):eade3814. doi: 10.1126/sciimmunol.ade3814. Epub 2024 May 24. 10.1126/sciimmunol.ade3814 PubMed 38787963