pLenti-CamKIIa-monSTIM1
(Plasmid
#161796)
-
PurposeLentiviral vector expressing monSTIM1 in neurons.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 161796 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLenti-EF1a-hChR2(H134R)-EYFP-WPRE
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEGFP-CRY2PHR(mon)-STIM1
-
Alt namemonSTIM1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3702
-
Entrez GeneSTIM1 (a.k.a. D11S4896E, GOK, IMD10, STRMK, TAM, TAM1)
- Promoter CamKIIa
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer GAGGAGCTGTTCACCGGGG
- 3′ sequencing primer aatccagaggttgattatcgataag
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-CamKIIa-monSTIM1 was a gift from Won Do Heo (Addgene plasmid # 161796 ; http://n2t.net/addgene:161796 ; RRID:Addgene_161796) -
For your References section:
Non-invasive optical control of endogenous Ca(2+) channels in awake mice. Kim S, Kyung T, Chung JH, Kim N, Keum S, Lee J, Park H, Kim HM, Lee S, Shin HS, Do Heo W. Nat Commun. 2020 Jan 10;11(1):210. doi: 10.1038/s41467-019-14005-4. 10.1038/s41467-019-14005-4 PubMed 31924789