Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLenti-CamKIIa-monSTIM1
(Plasmid #161796)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 161796 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLenti-EF1a-hChR2(H134R)-EYFP-WPRE
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    EGFP-CRY2PHR(mon)-STIM1
  • Alt name
    monSTIM1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3702
  • Entrez Gene
    STIM1 (a.k.a. D11S4896E, GOK, IMD10, STRMK, TAM, TAM1)
  • Promoter CamKIIa
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer GAGGAGCTGTTCACCGGGG
  • 3′ sequencing primer aatccagaggttgattatcgataag
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-CamKIIa-monSTIM1 was a gift from Won Do Heo (Addgene plasmid # 161796 ; http://n2t.net/addgene:161796 ; RRID:Addgene_161796)
  • For your References section:

    Non-invasive optical control of endogenous Ca(2+) channels in awake mice. Kim S, Kyung T, Chung JH, Kim N, Keum S, Lee J, Park H, Kim HM, Lee S, Shin HS, Do Heo W. Nat Commun. 2020 Jan 10;11(1):210. doi: 10.1038/s41467-019-14005-4. 10.1038/s41467-019-14005-4 PubMed 31924789