Skip to main content

pLV.PGK.hLHX6
(Plasmid #161828)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 161828 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLKO.1
  • Backbone size w/o insert (bp) 7026
  • Total vector size (bp) 8205
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human LHX6
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1179
  • Mutation
    AA 17-23 deletion
  • GenBank ID
    NM_014368.5
  • Entrez Gene
    LHX6 (a.k.a. LHX6.1)
  • Promoter PGK

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer ggacagcgccagggagcaat
  • 3′ sequencing primer catagttaagaataccag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that the Addgene full sequence differs from the depositor's sequence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV.PGK.hLHX6 was a gift from Daniella Ottosson (Addgene plasmid # 161828 ; http://n2t.net/addgene:161828 ; RRID:Addgene_161828)
  • For your References section:

    Direct Conversion of Human Stem Cell-Derived Glial Progenitor Cells into GABAergic Interneurons. Giacomoni J, Bruzelius A, Stamouli CA, Rylander Ottosson D. Cells. 2020 Nov 10;9(11). pii: cells9112451. doi: 10.3390/cells9112451. 10.3390/cells9112451 PubMed 33182669