Skip to main content

ampl43
(Plasmid #161830)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 161830 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRS416
  • Backbone manufacturer
    Ronald Davis (Addgene Plasmid #73796)
  • Vector type
    Yeast Expression, CRISPR
  • Promoter TEF1
  • Selectable markers
    HIS3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTCTTTCGATGACCTCCCATTG
  • 3′ sequencing primer gtaatacgactcactataggg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ampl43 was a gift from Saeed Tavazoie (Addgene plasmid # 161830 ; http://n2t.net/addgene:161830 ; RRID:Addgene_161830)
  • For your References section:

    An inducible CRISPR interference library for genetic interrogation of Saccharomyces cerevisiae biology. Momen-Roknabadi A, Oikonomou P, Zegans M, Tavazoie S. Commun Biol. 2020 Nov 27;3(1):723. doi: 10.1038/s42003-020-01452-9. 10.1038/s42003-020-01452-9 PubMed 33247197