HTT delta-exon1
(Plasmid
#162274)
-
PurposeBaculovirus and mammalian expression
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 162274 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepBacMam2-DiEx-LIC
-
Backbone manufacturerOxford SGC
-
Vector typeMammalian Expression ; Baculovirus Expresssion
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHTT
-
Alt nameHTT delta-exon1 construct, SGC Toronto
-
Alt namehuntingtin:TOC017-E07:C242692
-
SpeciesH. sapiens (human)
-
Entrez GeneHTT (a.k.a. HD, IT15, LOMARS)
- Promoter CMV and P10
-
Tag
/ Fusion Protein
- 10xHis-Flag (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer pFBM-F: caaaatgtcgtaacaactccgc
- 3′ sequencing primer pFBM-R: tagttaagaataccagtcaatctttcac (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
N-terminal tag: M. C-terminal tag: aenlyfqshhhhhhhhhhdykddddk. SGC Clone ID: huntingtin:TOC017-E07:C242692.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HTT delta-exon1 was a gift from Cheryl Arrowsmith (Addgene plasmid # 162274 ; http://n2t.net/addgene:162274 ; RRID:Addgene_162274)