Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

HTT delta-exon1
(Plasmid #162274)


Item Catalog # Description Quantity Price (USD)
Plasmid 162274 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Oxford SGC
  • Vector type
    Mammalian Expression ; Baculovirus Expresssion

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
    HTT delta-exon1 construct, SGC Toronto
  • Alt name
  • Species
    H. sapiens (human)
  • Entrez Gene
    HTT (a.k.a. HD, IT15, LOMARS)
  • Promoter CMV and P10
  • Tag / Fusion Protein
    • 10xHis-Flag (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer pFBM-F: caaaatgtcgtaacaactccgc
  • 3′ sequencing primer pFBM-R: tagttaagaataccagtcaatctttcac
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

N-terminal tag: M. C-terminal tag: aenlyfqshhhhhhhhhhdykddddk. SGC Clone ID: huntingtin:TOC017-E07:C242692.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    HTT delta-exon1 was a gift from Cheryl Arrowsmith (Addgene plasmid # 162274)