Skip to main content

Human Transcription Factor Knockout Library
(Pooled Library #162275, #162275-LV)

  • Purpose

    This lentiviral CRISPR knockout library targets 1,639 human transcription factors for comprehensive loss-of-function screens.

  • Vector Backbone

    lentiGuide-Puro (Plasmid #52963) - does not express Cas9

Ordering

Item Catalog # Description Quantity Price (USD)
Pooled Library 162275 Lenti-human-TF-gRNA-puromycin† 1 $451 Add to Cart
Lentiviral Prep 162275-LV Virus (1.3×108 TU, titer ≥ 1×107 TU/mL) and Pooled Library DNA More Information 1 $2353 Add to Cart
Available to Academic and Nonprofits Only
  • † A Cas9 plasmid is NOT included with this item and will have to be ordered separately. Plasmid(s) such as lentiCas9-Blast (Addgene #52962) or cell lines expressing SpCas9 can be used.

Library Details

  • Species
    Human
  • Genes targeted
    1,639
  • Total gRNAs
    11,364
  • Controls
    100 non-targeting gRNAs
  • Lentiviral Generation
    3rd

Library Shipping

This library is delivered as suspended DNA in a microcentrifuge tube on blue ice. The tube's contents will not necessarily be frozen. For best results, minimize freeze/thaws.

  • Volume
    ∼20 µL
  • Concentration
    50 ng/µL

Resource Information

Depositor Comments

Schematic of the generation and use of the human transcription factor CRISPR knockout library. Library contains 1,639 transcription factors with an average of seven gRNAs per gene and 100 negative controls. Concurrently, a reporter cell line is made using a knock in reporter and Cas9. The library is introduced to the cell line and sorted by FACS based on the reporter. DNA is collected and sequenced using deep sequencing to identify enriched gRNAs.

Figure 1: Overview of the human transcription factor CRISPR knockout library.

Information for Lentiviral Prep (Catalog # 162275-LV) ( Back to top )

Purpose

Ready-to-use lentiviral pooled library for CRISPR screening in human cells. Targets 1,639 transcription factors. Lentiviral particles carrying Human Transcription Factor Knockout Library in lentiGuide-Puro.

Delivery

  • Volume Varies depending on titer.
  • Titer ≥ 1 × 107 TU/mL
  • Storage Store at -80 °C. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Pooled Library DNA (10 µL at 50 ng/µL) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids psPAX2 (plasmid #12260)
  • Envelope pMD2.G (plasmid #12259)
  • Buffer OptiPRO SFM
  • Selectable Marker Puromycin

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Pooled Library Representation:
  • To confirm library representation and distribution, we perform next-generation sequencing on the purified plasmid DNA pool that was used to generate lentivirus.

Titering Method:
  • ddPCR: 293T cells are transduced with serial dilutions of 162275-LV, harvested several days later, and genomic DNA is isolated. Copies of RRE are measured and normalized to RPP30.
PCR confirmation of insert:
  • PCR was carried out with primers targeting U6 and EF1-alpha promoters. The PCR product was visualized on an agarose gel for size confirmation.
    • Forward primer: GAGGGCCTATTTCCCATGATT
    • Reverse Primer: CACGGCGACTACTGCACTTA

Visit our viral production page for more information.

Addgene Comments

Shipment specifications:

Pooled libraries containing at least 1.3 × 108 infectious units are shipped on dry ice at a titer of ≥ 1 × 107 TU/mL. The total volume is divided among several large aliquots and one 1.3 mL aliquot for testing. Each viral service request also includes virus associated DNA, which is a sample of the purified plasmid DNA pool that was used to generate lentivirus.

How to use this virus:

We recommend using the testing aliquot of virus to determine optimal infection conditions before performing screening-scale infections. Detailed methods for determining optimal infection conditions, screening, and validating hits are described in the original publication. Before using this virus, Addgene strongly recommends reading the original publication (Zhang et al., 2020 (Link opens in a new window)).

How to use the virus associated DNA:

Distribution of this pooled lentiviral library includes virus associated DNA, which is a sample of the purified plasmid DNA pool that was used to generate lentivirus.

  • This purified plasmid DNA pool can be sequenced and used as the starting plasmid DNA (pDNA) pool reference when performing screen analysis. As described in the original publication (Zhang et al., 2020 (Link opens in a new window)), perform screen analysis by determining the log2-fold-change of each single-guide RNA relative to the pDNA pool. The pDNA has been shown to serve as a good surrogate for an early time point and is more cost effective when performing many screens (Shalem et al., 2014 (Link opens in a new window)).

  • The purified plasmid DNA pool can be amplified to make more pooled plasmid library stock DNA. See our Library Amplification Protocol (DOCX, 15 KB) for more information.

How to cite this pooled library ( Back to top )

These pooled libraries were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lenti-human-TF-gRNA-puromycin library was a gift from Chunliang Li (Addgene #162275 ; http://n2t.net/addgene:162275 ; RRID:Addgene_162275)
    Lenti-human-TF-gRNA-puromycin library was a gift from Chunliang Li (Addgene #162275-LV ; http://n2t.net/addgene:162275-LV ; RRID:Addgene_162275-LV)
  • For your References section:

    Functional interrogation of HOXA9 regulome in MLLr leukemia via reporter-based CRISPR/Cas9 screen. Zhang H, Zhang Y, Zhou X, Wright S, Hyle J, Zhao L, An J, Zhao X, Shao Y, Xu B, Lee HM, Chen T, Zhou Y, Chen X, Lu R, Li C. eLife. 2020 Oct 1;9. pii: 57858. doi: 10.7554/eLife.57858. PubMed 33001025 (Link opens in a new window)