Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pG3
(Plasmid #162604)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 162604 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRS416
  • Vector type
    Yeast Expression
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Tef1-Cas9 with RPL25 Intron
  • gRNA/shRNA sequence
    GTATAATGTCCAGAGTTGTG
  • Species
    Synthetic

Cloning Information

  • Cloning method Gibson Cloning

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This vector was designed as part of a CRISPR course. Please see the following link for an annotated sequence map from the depositing laboratory: https://benchling.com/s/seq-OdXuEBwMt6TART0lKUL5

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pG3 was a gift from Lars Steinmetz (Addgene plasmid # 162604 ; http://n2t.net/addgene:162604 ; RRID:Addgene_162604)
  • For your References section:

    CRISPR-Cas9 Gene Editing in Yeast: A Molecular Biology and Bioinformatics Laboratory Module for Undergraduate and High School Students. Sankaran SM, Smith JD, Roy KR. J Microbiol Biol Educ. 2021 May 31;22(2):e00106-21. doi: 10.1128/jmbe.00106-21. eCollection 2021 Fall. 10.1128/jmbe.00106-21 PubMed 34594460