pG3
(Plasmid
#162604)
-
PurposeEdit Ade2 gene in yeast
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 162604 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRS416
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTef1-Cas9 with RPL25 Intron
-
gRNA/shRNA sequenceGTATAATGTCCAGAGTTGTG
-
SpeciesSynthetic
Cloning Information
- Cloning method Gibson Cloning
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This vector was designed as part of a CRISPR course. Please see the following link for an annotated sequence map from the depositing laboratory: https://benchling.com/s/seq-OdXuEBwMt6TART0lKUL5
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pG3 was a gift from Lars Steinmetz (Addgene plasmid # 162604 ; http://n2t.net/addgene:162604 ; RRID:Addgene_162604) -
For your References section:
CRISPR-Cas9 Gene Editing in Yeast: A Molecular Biology and Bioinformatics Laboratory Module for Undergraduate and High School Students. Sankaran SM, Smith JD, Roy KR. J Microbiol Biol Educ. 2021 May 31;22(2):e00106-21. doi: 10.1128/jmbe.00106-21. eCollection 2021 Fall. 10.1128/jmbe.00106-21 PubMed 34594460