Skip to main content

pET24a-LaM4-3xTS
(Plasmid #162777)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 162777 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET24a
  • Backbone manufacturer
    Merck - Novagen
  • Total vector size (bp) 5858
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    anti-mCherry nanobody fused to three TS sites, T7, HA, BAP and His6 epitope
  • Alt name
    LaM4
  • Species
    Synthetic
  • Insert Size (bp)
    648
  • Promoter T7
  • Tags / Fusion Proteins
    • T7 (N terminal on insert)
    • HA (C terminal on insert)
    • BAP (C terminal on insert)
    • His6 (C terminal on insert)
    • TS site from proCCK (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TGCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Vectors are based on Buser et al., 2018 (PNAS), and Buser and Spiess, 2019 (JoVE) (https://www.addgene.org/Martin_Spiess/) The anti-mCherry nanobody sequence (LaM4) is based on Fridy et al., 2014 (Nature Methods)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET24a-LaM4-3xTS was a gift from Martin Spiess (Addgene plasmid # 162777 ; http://n2t.net/addgene:162777 ; RRID:Addgene_162777)
  • For your References section:

    Retrograde transport of CDMPR depends on several machineries as analyzed by sulfatable nanobodies. Buser DP, Bader G, Spiess M. Life Sci Alliance. 2022 Mar 21;5(7). pii: 5/7/e202101269. doi: 10.26508/lsa.202101269. Print 2022 Mar. 10.26508/lsa.202101269 PubMed 35314489