Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTM
(Plasmid #162783)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 162783 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    p1.1
  • Backbone manufacturer
    LMBT, LTD
  • Backbone size (bp) 11914
  • Modifications to backbone
    Truncated EEF1A1 DFR and UFR sequences; hTPA signal peptide, c-myc, and 10xHis coding sequences added
  • Vector type
    Mammalian Expression
  • Promoter CHO Elongation factor 1A
  • Selectable markers
    HT/MTX
  • Tags / Fusion Proteins
    • hTPA leader (N terminal on backbone)
    • c-myc (C terminal on backbone)
    • 10xHis (C terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer SQ-5CH6-F GCCGCTGCTTCCTGTGAC
  • 3′ sequencing primer IRESArev aggtttccgggccctcacattg; SQ-MycH-R gatgaccgcctgcagac
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTM was a gift from Ivan Vorobiev (Addgene plasmid # 162783 ; http://n2t.net/addgene:162783 ; RRID:Addgene_162783)
  • For your References section:

    High-level expression of the monomeric SARS-CoV-2 S protein RBD 320-537 in stably transfected CHO cells by the EEF1A1-based plasmid vector. Sinegubova MV, Orlova NA, Kovnir SV, Dayanova LK, Vorobiev II. PLoS One. 2021 Feb 2;16(2):e0242890. doi: 10.1371/journal.pone.0242890. eCollection 2021. 10.1371/journal.pone.0242890 PubMed 33529230