Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pHYP-NPC-10H
(Plasmid #162789)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 162789 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET28
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5369
  • Modifications to backbone
    Hok/Sok element added, Rop-element deleted
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    DH5alpha for cloning, BL21(DE3) for protein induction
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Nucleocapsid phosphoprotein [Severe acute respiratory syndrome coronavirus 2]
  • Alt name
    NP
  • Species
    Severe acute respiratory syndrome coronavirus 2
  • Insert Size (bp)
    1293
  • GenBank ID
    YP_009724397.2
  • Entrez Gene
    N (a.k.a. GU280_gp10)
  • Promoter T7lac
  • Tag / Fusion Protein
    • 10xHis (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI/PciI (destroyed during cloning)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer T7prom TAATACGACTCACTATAGGG
  • 3′ sequencing primer T7term GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Insert DNA was synthesized by Twist Bioscience

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHYP-NPC-10H was a gift from Ivan Vorobiev (Addgene plasmid # 162789 ; http://n2t.net/addgene:162789 ; RRID:Addgene_162789)
  • For your References section:

    Antigenic properties of the SARS-CoV-2 nucleoprotein are altered by the RNA admixture. Kolesov DE, Sinegubova MV, Safenkova IV, Vorobiev II, Orlova NA. PeerJ. 2022 Jan 7;10:e12751. doi: 10.7717/peerj.12751. eCollection 2022. 10.7717/peerj.12751 PubMed 35036106