pHYP-NPC-10H
(Plasmid #162789)

• Purpose: SARS-CoV-2 Nucleocapsid Protein expression in E.coli
• Depositing Lab: Ivan Vorobiev
• Publication: Kolesov et al PeerJ. 2022 Jan 7;10:e12751. doi: 10.7717/peerj.12751. eCollection 2022.

Backbone

• Vector backbone: pET28
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 5369
• Modifications to backbone: Hok/Sok element added, Rop-element deleted
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: DH5alpha for cloning, BL21(DE3) for protein induction
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Nucleocapsid phosphoprotein [Severe acute respiratory syndrome coronavirus 2]
• Alt name: NP
• Species: Severe acute respiratory syndrome coronavirus 2
• Insert Size (bp): 1293
• GenBank ID: YP_009724397.2
• Entrez Gene: N (a.k.a. GU280_gp10)
• Promoter: T7lac
• Tag / Fusion Protein:
  • 10xHis (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI/PciI (destroyed during cloning)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: T7prom TAATACGACTCACTATAGGG
• 3′ sequencing primer: T7term GCTAGTTATTGCTCAGCGG

Resource Information

• Supplemental Documents:
  • pHYP-NPC-10H.gb
• A portion of this plasmid was derived from a plasmid made by: Insert DNA was synthesized by Twist Bioscience

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry