Skip to main content

LAMP1-GFP
(Plasmid #16290)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 16290 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAc5.1/V5-His B
  • Backbone size w/o insert (bp) 5400
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    LAMP1/RE72002
  • Species
    D. melanogaster (fly)
  • Insert Size (bp)
    954
  • Promoter Ac5
  • Tag / Fusion Protein
    • EGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Kpn I (not destroyed)
  • 3′ cloning site Not I (not destroyed)
  • 5′ sequencing primer AC5 (ACACAAAGCCGCTCCATCAG)
  • 3′ sequencing primer EBV-rev
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that KpnI is not a unique site, as it flanks LAMP1.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LAMP1-GFP was a gift from Ron Vale (Addgene plasmid # 16290 ; http://n2t.net/addgene:16290 ; RRID:Addgene_16290)
  • For your References section:

    Regulation of mitochondria distribution by RhoA and formins. Minin AA, Kulik AV, Gyoeva FK, Li Y, Goshima G, Gelfand VI. J Cell Sci. 2006 Feb 15. 119(Pt 4):659-70. 10.1242/jcs.02762 PubMed 16434478