Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #16290)


Item Catalog # Description Quantity Price (USD)
Plasmid 16290 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    D. melanogaster (fly)
  • Insert Size (bp)
  • Promoter Ac5
  • Tag / Fusion Protein
    • EGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Kpn I (not destroyed)
  • 3′ cloning site Not I (not destroyed)
  • 5′ sequencing primer AC5 (ACACAAAGCCGCTCCATCAG)
  • 3′ sequencing primer EBV-rev
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Please note that KpnI is not a unique site, as it flanks LAMP1.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LAMP1-GFP was a gift from Ron Vale (Addgene plasmid # 16290 ; ; RRID:Addgene_16290)
  • For your References section:

    Regulation of mitochondria distribution by RhoA and formins. Minin AA, Kulik AV, Gyoeva FK, Li Y, Goshima G, Gelfand VI. J Cell Sci. 2006 Feb 15. 119(Pt 4):659-70. 10.1242/jcs.02762 PubMed 16434478