Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

GFP shRNA tet pLKO puro
(Plasmid #163017)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 163017 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Tet-pLKO-puro
  • Backbone size w/o insert (bp) 8762
  • Total vector size (bp) 8816
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Enhanced Green Fluorescent Protein
  • Alt name
    eGFP
  • gRNA/shRNA sequence
    TACAACAGCCACAACGTCTAT

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GGCAGGGATATTCACCATTATCGTTTCAGA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Original backbone from Wiederschain et al., Cell Cycle. 2009 Feb 1. 8(3):498-504
Addgene #21915

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GFP shRNA tet pLKO puro was a gift from Mark Rubin (Addgene plasmid # 163017 ; http://n2t.net/addgene:163017 ; RRID:Addgene_163017)
  • For your References section:

    Mapping of m6A and Its Regulatory Targets in Prostate Cancer Reveals a METTL3-low Induction of Therapy Resistance. Cotter KA, Gallon J, Uebersax N, Rubin P, Meyer KD, Piscuoglio S, Jaffrey SR, Rubin MA. Mol Cancer Res. 2021 Jun 4. pii: 1541-7786.MCR-21-0014. doi: 10.1158/1541-7786.MCR-21-0014. 10.1158/1541-7786.MCR-21-0014 PubMed 34088870