pKLV2-U6gRNA5(hYAP1-Y2B)-PGKpuro2ABFP-W
(Plasmid
#163178)
-
PurposeLentiviral gRNA plasmid targeting human YAP1 gene, co-expression of BFP tag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 163178 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepKLV2-U6gRNA5(BbsI)-PGKpuro2ABFP-W
- Total vector size (bp) 8650
-
Modifications to backboneUsed BbsI enzyme to clone in gRNA targeting human YAP1 gene
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameYAP1
-
gRNA/shRNA sequenceGTGCACGATCTGATGCCCGG
-
SpeciesH. sapiens (human)
-
Entrez GeneYAP1 (a.k.a. COB1, YAP, YAP-1, YAP2, YAP65, YKI)
- Promoter U6
-
Tag
/ Fusion Protein
- BFP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer AGATAATTAGAATTAATTTGACTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKLV2-U6gRNA5(hYAP1-Y2B)-PGKpuro2ABFP-W was a gift from Sok Ching Cheong (Addgene plasmid # 163178 ; http://n2t.net/addgene:163178 ; RRID:Addgene_163178) -
For your References section:
Genome-wide CRISPR screens of oral squamous cell carcinoma reveal fitness genes in the Hippo pathway. Chai AWY, Yee PS, Price S, Yee SM, Lee HM, Tiong VK, Goncalves E, Behan FM, Bateson J, Gilbert J, Tan AC, McDermott U, Garnett MJ, Cheong SC. Elife. 2020 Sep 29;9. pii: 57761. doi: 10.7554/eLife.57761. 10.7554/eLife.57761 PubMed 32990596