p8103 LentiCRISPR v2 sgNT-2
(Plasmid
#163313)
-
PurposeExpresses Cas9 and a non-targeting control guide RNA
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 163313 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneLentiCRISPR v2
-
Vector typeLentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgNT-2
-
gRNA/shRNA sequenceGATTGTGGTCGCTCAAAACC
-
SpeciesSynthetic
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer Human U6.F
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p8103 LentiCRISPR v2 sgNT-2 was a gift from Elizabeth White (Addgene plasmid # 163313 ; http://n2t.net/addgene:163313 ; RRID:Addgene_163313) -
For your References section:
PTPN14 degradation by high-risk human papillomavirus E7 limits keratinocyte differentiation and contributes to HPV-mediated oncogenesis. Hatterschide J, Bohidar AE, Grace M, Nulton TJ, Kim HW, Windle B, Morgan IM, Munger K, White EA. Proc Natl Acad Sci U S A. 2019 Apr 2;116(14):7033-7042. doi: 10.1073/pnas.1819534116. Epub 2019 Mar 20. 10.1073/pnas.1819534116 PubMed 30894485