pRM14
(Plasmid
#163693)
-
Purposehsp70 promoter inducible expression of DHB:mNeonGreen-P2A-H2B:mScarlet
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 163693 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneTol2
- Backbone size w/o insert (bp) 7854
- Total vector size (bp) 10029
-
Modifications to backbonemammalian DNA helicase B (DHB) amino acids 994-1087 fused to mNeonGreen co-expressed with H2B::mScarlet cloned between BamHI and ClaI sites
-
Vector typeUnspecified ; Zebrafish expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDHB:mNeonGreen-P2A-H2B:mScarlet
-
Alt nameDNA Helicase B (CDK sensor) (aa 994–1087) (HELB)
-
Alt nameH2BC11
-
SpeciesH. sapiens (human)
-
GenBank IDNM_021058.4 NM_001370285.1
-
Entrez GeneHELB (a.k.a. DHB, hDHB)
-
Entrez GeneH2BC11 (a.k.a. H2B/r, H2BFR, H2BJ, HIST1H2BJ)
- Promoter HSP70
-
Tags
/ Fusion Proteins
- mNeonGreen (C terminal on insert)
- mScarlet (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATTTAGGTGACACTATAG
- 3′ sequencing primer ATTAACCCTCACTAAAGGGA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
DNA Helicase B (DHB) as a CDK sensor described in:
Hahn, A.T., Jones, J.T., and Meyer, T. (2009). Quantitative analysis of cell cycle phase durations and PC12 differentiation using fluorescent biosensors. Cell Cycle 8, 1044-1052.
Spencer, S.L., Cappell, S.D., Tsai, F.C., Overton, K.W., Wang, C.L., and Meyer, T. (2013). The proliferation-quiescence decision is controlled by a bifurcation in CDK2 activity at mitotic exit. Cell 155, 369-383.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRM14 was a gift from David Matus (Addgene plasmid # 163693 ; http://n2t.net/addgene:163693 ; RRID:Addgene_163693) -
For your References section:
Visualizing the metazoan proliferation-quiescence decision in vivo. Adikes RC, Kohrman AQ, Martinez MAQ, Palmisano NJ, Smith JJ, Medwig-Kinney TN, Min M, Sallee MD, Ahmed OB, Kim N, Liu S, Morabito RD, Weeks N, Zhao Q, Zhang W, Feldman JL, Barkoulas M, Pani AM, Spencer SL, Martin BL, Matus DQ. Elife. 2020 Dec 22;9. pii: 63265. doi: 10.7554/eLife.63265. 10.7554/eLife.63265 PubMed 33350383