-
PurposeExpresses psychLight2 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 163910 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEGFP_N1
- Backbone size w/o insert (bp) 3988
- Total vector size (bp) 6100
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepsychLight2
-
SpeciesSynthetic
-
Insert Size (bp)2112
-
GenBank ID2403243
- Promoter CAG
-
Tag
/ Fusion Protein
- Flag tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer atgaagacgatcatcgccctgagc
- 3′ sequencing primer ttacacctcgttctcgtagcagaatac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV_psychLight2 was a gift from Lin Tian (Addgene plasmid # 163910 ; http://n2t.net/addgene:163910 ; RRID:Addgene_163910) -
For your References section:
Psychedelic-inspired drug discovery using an engineered biosensor. Dong C, Ly C, Dunlap LE, Vargas MV, Sun J, Hwang IW, Azinfar A, Oh WC, Wetsel WC, Olson DE, Tian L. Cell. 2021 Apr 8. pii: S0092-8674(21)00374-3. doi: 10.1016/j.cell.2021.03.043. 10.1016/j.cell.2021.03.043 PubMed 33915107