Skip to main content

Lenti_EFS-Cas9-P2A-HygR
(Plasmid #164134)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164134 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    lentiCas9-Blast plasmid (Addgene #52962)
  • Backbone size w/o insert (bp) 7700
  • Total vector size (bp) 13489
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SpCas9
  • Species
    Synthetic
  • Insert Size (bp)
    6000
  • Entrez Gene
    cas9 (a.k.a. B6D67_RS04280, ERS445054_00848)
  • Promoter EFS

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CCTGCCGCCACAAAGAAGGCTGG
  • 3′ sequencing primer gcaacatagttaagaatacc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lenti_EFS-Cas9-P2A-HygR was a gift from Hyongbum Kim (Addgene plasmid # 164134 ; http://n2t.net/addgene:164134 ; RRID:Addgene_164134)
  • For your References section:

    Recording of elapsed time and temporal information about biological events using Cas9. Park J, Lim JM, Jung I, Heo SJ, Park J, Chang Y, Kim HK, Jung D, Yu JH, Min S, Yoon S, Cho SR, Park T, Kim HH. Cell. 2021 Jan 28. pii: S0092-8674(21)00014-3. doi: 10.1016/j.cell.2021.01.014. 10.1016/j.cell.2021.01.014 PubMed 33539780