Cre-responsive Cas9 expressing transposon library vector
(Plasmid
#164138)
-
Purpose(Empty Backbone) Backbone for transposon stgRNA library construction (library 4) (SpCas9 expression is induced upon Cre-loxP recombination.)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 164138 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepT2
- Backbone size (bp) 3000
-
Vector typeMammalian Expression, Cre/Lox, CRISPR, Synthetic Biology
- Promoter human U6, EF-1a
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsDue to innate characteristic of high recombination rate, this vector should be checked for undesired recombination by cutting the specific cut sites with restriction enzyme.
-
Copy numberHigh Copy
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GGCACCGGAGCCTTAAAAGG
- 3′ sequencing primer GAATAAATGAAAGCTTGCAGATCTGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Cre-responsive Cas9 expressing transposon library vector was a gift from Hyongbum Kim (Addgene plasmid # 164138 ; http://n2t.net/addgene:164138 ; RRID:Addgene_164138) -
For your References section:
Recording of elapsed time and temporal information about biological events using Cas9. Park J, Lim JM, Jung I, Heo SJ, Park J, Chang Y, Kim HK, Jung D, Yu JH, Min S, Yoon S, Cho SR, Park T, Kim HH. Cell. 2021 Jan 28. pii: S0092-8674(21)00014-3. doi: 10.1016/j.cell.2021.01.014. 10.1016/j.cell.2021.01.014 PubMed 33539780