Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Cre-responsive Cas9 expressing transposon library vector
(Plasmid #164138)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 164138 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pT2
  • Backbone size (bp) 3000
  • Vector type
    Mammalian Expression, Cre/Lox, CRISPR, Synthetic Biology
  • Promoter human U6, EF-1a
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Due to innate characteristic of high recombination rate, this vector should be checked for undesired recombination by cutting the specific cut sites with restriction enzyme.
  • Copy number
    High Copy

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GGCACCGGAGCCTTAAAAGG
  • 3′ sequencing primer GAATAAATGAAAGCTTGCAGATCTGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Cre-responsive Cas9 expressing transposon library vector was a gift from Hyongbum Kim (Addgene plasmid # 164138 ; http://n2t.net/addgene:164138 ; RRID:Addgene_164138)
  • For your References section:

    Recording of elapsed time and temporal information about biological events using Cas9. Park J, Lim JM, Jung I, Heo SJ, Park J, Chang Y, Kim HK, Jung D, Yu JH, Min S, Yoon S, Cho SR, Park T, Kim HH. Cell. 2021 Jan 28. pii: S0092-8674(21)00014-3. doi: 10.1016/j.cell.2021.01.014. 10.1016/j.cell.2021.01.014 PubMed 33539780