pAAV Syn CaMPARI2-F391W_L398V-human-a-Tubulin (high affinity TubuTag)
(Plasmid
#164193)
-
PurposeFreeze-frame imaging of dendritic calcium signals High calcium affinity (CaMPARI2_F391W_L398V moiety Kd=174nM)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 164193 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 4579
- Total vector size (bp) 7275
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameCamPARI2
-
SpeciesSynthetic
-
Insert Size (bp)1306
-
MutationF391W-L398V
- Promoter Syn
-
Tags
/ Fusion Proteins
- NES (N terminal on insert)
- 6 His tag (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site Bsp1407I (not destroyed)
- 5′ sequencing primer GACTCAGCGCTGCCTCAGTCTG
- 3′ sequencing primer CTTGTACATTGAGCTCAGCCGACCTATAG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameHuman α Tubulin
-
Alt nameh a Tubulin
-
Alt nameTubuTag high affinity
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1353
- Promoter Syn
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site Bgl II (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ctattttaagcagtcgtttc
- 3′ sequencing primer GGCATTAAAGCAGCGTATCC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byWe kindly received CaMPARI2 fromEric Schreiter, Janelia farm USA and Human α Tubulin was a kind gift from Marina Mikhaylova's lab
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV Syn CaMPARI2-F391W_L398V-human-a-Tubulin (high affinity TubuTag) was a gift from Thomas Oertner (Addgene plasmid # 164193 ; http://n2t.net/addgene:164193 ; RRID:Addgene_164193) -
For your References section:
Freeze-Frame Imaging of Dendritic Calcium Signals With TubuTag. Perez-Alvarez A, Huhn F, Durst CD, Franzelin A, Lamothe-Molina PJ, Oertner TG. Front Mol Neurosci. 2021 Mar 4;14:635820. doi: 10.3389/fnmol.2021.635820. eCollection 2021. 10.3389/fnmol.2021.635820 PubMed 33762909