pMTP140 (pBAD322G_TniQ-Cascade(Tn6900))
(Plasmid
#164262)
-
PurposeVector expressing the TniQ, Cas8/5, Cas7, and Cas6 proteins from the Tn6900 element with an arabinose promoter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 164262 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBAD322G
- Backbone size w/o insert (bp) 4357
- Total vector size (bp) 9320
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCodon-optimized tniQ-cas8/5-cas7-cas6 operon from Tn6900 from A. salmonicida S44 pS44-1
-
SpeciesAeromonas salmonicida
-
Insert Size (bp)5006
-
GenBank IDNZ_CP022176.1 DQ119284.1
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTAACAAAGCGGGACCAAAG
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Reference for vector backbone.
Cronan, J. E. (2006). A family of arabinose-inducible Escherichia coli expression vectors having pBR322 copy control. Plasmid, 55(2), 152–157. http://doi.org/10.1016/j.plasmid.2005.07.001
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMTP140 (pBAD322G_TniQ-Cascade(Tn6900)) was a gift from Joseph Peters (Addgene plasmid # 164262 ; http://n2t.net/addgene:164262 ; RRID:Addgene_164262) -
For your References section:
Guide RNA Categorization Enables Target Site Choice in Tn7-CRISPR-Cas Transposons. Petassi MT, Hsieh SC, Peters JE. Cell. 2020 Nov 30. pii: S0092-8674(20)31464-1. doi: 10.1016/j.cell.2020.11.005. 10.1016/j.cell.2020.11.005 PubMed 33271061