pMTP170 (pBAD33_CRISPR(Tn6900)-entry)
(Plasmid
#164263)
-
Purpose(Empty Backbone) Entry vector for cloning user-defined spacers in the Tn6900 CRISPR array.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 164263 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBAD33
- Backbone size (bp) 5352
-
Modifications to backboneRemoved additional BsaI site downstream of MCS with a single base substitution to accommodate cloning method. Original sequence = gagccggtgagcgtgggtctcgcggtatc. New sequence = gagccggtgagcgtgggactcgcggtatc.
-
Vector typeBacterial Expression
- Promoter Arabinose
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTAACAAAGCGGGACCAAAG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Reference for vector backbone.
Guzman, L. M., Belin, D., Carson, M. J., & Beckwith, J. (1995). Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter. Journal of Bacteriology, 177(14), 4121–4130.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMTP170 (pBAD33_CRISPR(Tn6900)-entry) was a gift from Joseph Peters (Addgene plasmid # 164263 ; http://n2t.net/addgene:164263 ; RRID:Addgene_164263) -
For your References section:
Guide RNA Categorization Enables Target Site Choice in Tn7-CRISPR-Cas Transposons. Petassi MT, Hsieh SC, Peters JE. Cell. 2020 Nov 30. pii: S0092-8674(20)31464-1. doi: 10.1016/j.cell.2020.11.005. 10.1016/j.cell.2020.11.005 PubMed 33271061