pXPR_070
(Plasmid
#164265)
-
PurposeLentiviral vector that enables Cre-mediated sgRNA expression. Also encodes the fluorophore violet-excited GFP (Vex) as a marker of transduction.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 164265 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepXPR_053
-
Backbone manufacturerArlene Sharpe's Lab
- Backbone size w/o insert (bp) 7670
- Total vector size (bp) 8050
-
Modifications to backbone(1) Removal of LacO sequence from U6 promoter. (2) Introduction of a stuffer into the stem loop of the Broad GPP chRNA V2. The stuffer contains transcriptional stops on the proximal 5’ and 3’ ends. This stuffer is flanked by loxP sequences that are in the same directional orientation.
-
Vector typeMammalian Expression, Lentiviral, Cre/Lox, CRISPR
-
Selectable markersVex fluorescent reporter
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA cassette
-
gRNA/shRNA sequenceNA
- Promoter Human U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer GACTATCATATGCTTACCGT
- 3′ sequencing primer TCTACTATTCTTTCCCCTGCACTGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pXPR_070 was a gift from Arlene Sharpe (Addgene plasmid # 164265 ; http://n2t.net/addgene:164265 ; RRID:Addgene_164265) -
For your References section:
X-CHIME enables combinatorial, inducible, lineage-specific and sequential knockout of genes in the immune system. LaFleur MW, Lemmen AM, Streeter ISL, Nguyen TH, Milling LE, Derosia NM, Hoffman ZM, Gillis JE, Tjokrosurjo Q, Markson SC, Huang AY, Anekal PV, Montero Llopis P, Haining WN, Doench JG, Sharpe AH. Nat Immunol. 2023 Nov 27. doi: 10.1038/s41590-023-01689-6. 10.1038/s41590-023-01689-6 PubMed 38012416